LINKS:
Molecular Pathogenesis
Ron Lab Home Page
Research program
Lab members
Selected Publications
Reagents
Experimental protocols for downloading
Comments and postings
Lab Safety, Logistics & Adminstrative Procedures
Lab meetings schedule
Sign ups

 

Detection of Chop::LacZ and wild-type Chop by three-primer PCR analysis

Description of mutant allele:

This knock-in allele of Chop (also known as Gadd153 and officially as Ddit3) was created by Fumihko Urano and XiaoZhong Wang. The Chop coding region, PmlI-NheI was replaced by the NLS-LacZ reporter and the floxxed PGK-NeoR selection cassette was excised, leaving a single loxP site 3’ of the SV40 terminator sequence, which is part of the NLS-LacZ cassette. The deletion in Chop removes the entire CDS except for the 34 C-terminal amino acids, it is identical in scope to the deletion described in Zinszner et al 1998 (allele name Chop.KO3). The predicted sequence of the wildtype mouse CHOP gene and CHOP::LacZ mutant allele, with annotation of primer binding sites, is available as embl files using the links provided herein.


Note: While this allele expresses LacZ protein and mRNA in a stress dependent manner in cultured cells explanted from Chop::LacZ/+ embryos, the utility of this reporter in the tissues of the mice is questionable. Tunicamycin-injected mice were stained for LacZ in their kidneys, a site of heavy endogenous CHOP expression under such circumstances and only very weak LacZ staining was observed. Needless to say the allele produces no detectable CHOP protein and cells explanted from this mutant allele are unable to activate CHOP target genes (see Marciniak et al 2004)

Primers:
mCh i2.1: ATGCCCTTACCTATCGTG
LacZ.4AS: AACGCCAGGGTTTTCCCAGTCA
TTLD: GCA GGG TCA AGA GTA GTGPCR

Products:
Chop::LacZ mutant allele (mCh.I2.1 vs. LacZ.4AS) 289bp
Wild type allele (mCh.I2.1 vs. TTLD) 545bp*
*note the presence of a ~150bp intron in the Chop gene between exon 4 (where TTLD is located) and exon 3.

PCR Conditions:
94¾ C, 4 min.
(94¾ C, 1 min; 57¾ C, 1 min. 30 sec.; 72¾ C, 1 min. 30 sec) x 35 cycles
72¾ C, 10 min.
4¾, indefinite

PCR Instructions:

In a total volume of 50 ul per reaction: Use 1ul each of LacZ.4AS (20pmol/ul stock) and TTLD (20pmol/ul stock) per reaction. Use 2 ul of mCh.I2.1 (20pmol/ul stock) per reaction. Use 5 ul of 10x PCR assay buffer (100mM Tris pH8.3, 500mM KCl, 15mM MgCl2). Use 5 ul of 10x stock of dNTPs (2.5mM)