Detection of P58IPK/DnajC3 knockout allele and wild-type allele by two-primer PCR analysis

Description of mutant allele:

This allele of P58ipk/DnajC3 was created by the Katze lab and is described in their publication: Ladiges WC, Knoblaugh SE, Morton JF, Korth MJ, Sopher BL, Baskin CR, MacAuley A, Goodman AG, LeBoeuf RC, Katze MG. Pancreatic beta-cell failure and diabetes in mice with a deletion mutation of the endoplasmic reticulum molecular chaperone gene P58IPK. (2005) Diabetes 54:1074-81

Note:
Our lab has used these mice in a study whose results were published: Oyadomari S, Yun C, Fisher EA, Kreglinger N, Kreibich G, Oyadomari M, Harding HP, Goodman AG, Harrant H, Garrision JL, Taunton J, Katze MG and Ron D. 2006. Co-Translocational degradation protects the stressed endoplasmic reticulum from protein overload. Cell. 126:727-739. Also see commentary by Pearce & Hebert, and a correction of an error and unpublished NEW INFORMATION on P58IPK/DnajC3

Primers:
Sense mp58.1S.katze: 5’ AGCCCGGCCTCCCCAGCCTCTTC 3’
Antisense mp58.2AS.katze: 5’ CCCGTCCACTCGCTCGCTCGCTC 3’

Products:
~310 bp WT
~260 bp KO

PCR Setup:
ddH2O 16.8mcL
10X buf 2.5mcL
2.5 mM dNTP 1.25mcL
20 uM SP 0.5mcL
20 uM AP 0.5mcL
homemade Taq 0.2mcL
DMSO 1.25mcL
genomic DNA 2mcL (a few mcg of HMW mouse genomic DNA)*
TOTAL volume 25mcL

*We get best results with high quality genomic DNA prepared by proteinase K treatment of the tail snip, followed by "fishing of the spool of HMW genomic DNA, but this assay has also worked with the cheaper and faster preparation of NaOH saponification of the tail.

PCR program:
Denature 94¾C 4 min
Denature 94¾C 1 min 35 cycles
Anneal & Extend 72¾C 1 min
Finish off at 72¾C 7 min
End

Buffer:
10x buffer (500mM Tris pH 9.0, 200mM NH4SO4, 15mM MgCl2)